View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974_high_8 (Length: 290)
Name: NF4974_high_8
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 194057 - 194335
Alignment:
| Q |
1 |
gtttggcagtgactttttgcacaccagaaaagctggggcaaagagatgagaaaagctagagatttagaagaagagaaggaagttgtgataggaaaaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194057 |
gtttggcagtgactttttgcacactagaaa-gctggggcaaagagatgagaaaagctagagatttagaagaagagaaggaagttgtgataggaaaaggat |
194155 |
T |
 |
| Q |
101 |
ttattagatttgaatggtttgaagatggttgggatgagaatgaaccaaaacggcttgacttggatgtgtatttgccacagctagagagggttgggaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
194156 |
ttattagatttgaatggtttgaagatggttgggatgaggatgaaccaaaacggcttgacttggatgtgtatttgccacaactagagatggttgggaaaca |
194255 |
T |
 |
| Q |
201 |
agtcctccctaccataatctcccaacaaaatccacctgtctcatgtttgattaataatcctttcattctatgggtctctg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
194256 |
agtcctccctaccataatctcccaacaaaatccacctgtctcatgtttgattaacaatcctttcattccatgggtttctg |
194335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University