View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974_low_12 (Length: 247)
Name: NF4974_low_12
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 25 - 247
Target Start/End: Original strand, 7127583 - 7127805
Alignment:
| Q |
25 |
tcttttcaataacatcatgatgatcagtgtcaatcttgttgaaattcagggacagcgacgaagaagttgcagtggcaacaattgtagaatccacaagatc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
7127583 |
tcttttcaataacatcatgatgatcagtgtcaatctcgttgaaattcagggacagcgacgaagaagttgcagtggctacaattgcagaatccacaagatc |
7127682 |
T |
|
| Q |
125 |
aacatcaacactgtgattttcagagaactctaattgttcttgacacgttgtatccgacacgtgtgaaggctcgtgtgtgagattatcagggcgtgtgaag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127683 |
aacatcaacactgtgattttcagagaacactaattgttcttgacacgttgtatccaacacgtgtgaaggctcgtgtgtgagattatcagggcgtgtgaag |
7127782 |
T |
|
| Q |
225 |
tttaactgaagtagggtccgttg |
247 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7127783 |
tttaactgaagtagggtccgttg |
7127805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University