View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974_low_13 (Length: 244)
Name: NF4974_low_13
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974_low_13 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 10202393 - 10202183
Alignment:
| Q |
18 |
taattttgatgcatggttctgtctcatctttatatcaggatgttatatcatttagcctaacttgtttctatcttgttcacctata--tatagttgcttcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10202393 |
taattttgatgcatggttctgtctcatctttatatcaggatgttatatcatttagccaaacttgtttctatcttgttcacctatatatatagttgcttcc |
10202294 |
T |
|
| Q |
116 |
tctctttctatcattcattgaatcagattgcaaaaacactctagagtcttttctctctannnnnnnnnaaaaaacttcttgagattaaacacatttttaa |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||| |
|
|
| T |
10202293 |
tctctttctatcactcattgaatcagattgcaaaaacactctagagtcttttctctcta-tttttttaaaaaaacttcttcagattaaacacatttctaa |
10202195 |
T |
|
| Q |
216 |
gaacacttatat |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10202194 |
gaacacttatat |
10202183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 166
Target Start/End: Original strand, 12272511 - 12272582
Alignment:
| Q |
95 |
cacctatatatagttgcttcctctctttctatcattcattgaatcagattgcaaaaacactctagagtcttt |
166 |
Q |
| |
|
||||||||||| ||||| ||| ||| |||| |||||||| |||||| |||||||| ||||||| ||||||| |
|
|
| T |
12272511 |
cacctatatatggttgcctccactcattctctcattcatagaatcaatttgcaaaatcactctaaagtcttt |
12272582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 171
Target Start/End: Complemental strand, 135201 - 135156
Alignment:
| Q |
126 |
tcattcattgaatcagattgcaaaaacactctagagtcttttctct |
171 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
135201 |
tcattcattgaatcaatttgcaaaatcactctaaagtcttttctct |
135156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University