View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974_low_17 (Length: 223)
Name: NF4974_low_17
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 5329662 - 5329482
Alignment:
| Q |
24 |
atcagaaaccaatactcaatcaatctcannnnnnncaattctatatgccaccacaaaattagtgttaattatcttgttttaatagatcaaattcattcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
5329662 |
atcagaaaccaatactcaatcaatctcatttttt-caattctatatgcctccacaaaattagtgttaattatcttgtcttaatagatcaaattaattcca |
5329564 |
T |
 |
| Q |
124 |
ttaacatattatagtgcattttatgtattaatttattgaagatttataaaatgtaccactcttttgcaattataactaatat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5329563 |
ttaacatattatagtgcattttatgtattaatttattgaagatttataaaatgtaccactcttttgcaattataactaatat |
5329482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University