View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4975-Insertion-1 (Length: 251)
Name: NF4975-Insertion-1
Description: NF4975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4975-Insertion-1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 30 - 249
Target Start/End: Complemental strand, 7908568 - 7908340
Alignment:
| Q |
30 |
tttgatactcactgattcatgacttgagataaacggacctgcagaatgttttggagacatttcactctatcctccgctatttgcatatcatctctgatac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7908568 |
tttgatactcactgattcatgacttgagataaacggacctgcagaatgttttggagacatttcactatatcctccgctatttgcatatcatctctgatac |
7908469 |
T |
|
| Q |
130 |
tttcatattgctctttgatacc---------cttcaaaaaattatccaacggaactgcctccttctgccggagaaactcaataactactttccacgctga |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7908468 |
tttcatattgctctttgatacccctcaaaatcttcaaaaaattatccaacggaactgcctccttctgccggagaaactcaataactactttccacgccga |
7908369 |
T |
|
| Q |
221 |
ttctttctcttcttccgagccagcaccat |
249 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
7908368 |
ttctttctcttcttccgaaccagcaccat |
7908340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University