View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4975-Insertion-6 (Length: 88)
Name: NF4975-Insertion-6
Description: NF4975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4975-Insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 7 - 86
Target Start/End: Complemental strand, 39792238 - 39792159
Alignment:
| Q |
7 |
acctgtttgtgtaaatatatatcatcactcaaactaaattttaatcaaatcaactttagaaactcaaattctatacaaat |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39792238 |
acctgtttgtgtaaatatatatcatcactcaaactcaattttaatcaaatcaactttagaaactcaaattctatacaaat |
39792159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 39786789 - 39786743
Alignment:
| Q |
30 |
atcactcaaactaaattttaatcaaatcaactttagaaactcaaatt |
76 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
39786789 |
atcactcaacctcaattttaatcaaatcaactttacaaactcaaatt |
39786743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University