View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4975_high_7 (Length: 253)
Name: NF4975_high_7
Description: NF4975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4975_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 40518689 - 40518906
Alignment:
| Q |
3 |
cttttgcaatgcaaggttggtttacaattggtttatagaacaacattcaacatattgtcaacaaaaccggtacgacctcataagtaatctttttgtagtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
40518689 |
cttttgcaatgcaaggttggtttacaattggtttatagaacaacattcaacatattgtcaacaaaaccggtacgacctcataattaatttttttgtagtt |
40518788 |
T |
|
| Q |
103 |
ataacatctcacggccagactttgcaactcataccgttagtttgttttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagac |
202 |
Q |
| |
|
| ||| |||||| ||| |||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40518789 |
agaacgtctcac-gccggactttgcaactcatatcgttagtttg-tttggattttatggaaggaccgcaatctcaaagtgtgggatgatgttacatagac |
40518886 |
T |
|
| Q |
203 |
ggttgctcaaatagttgaca |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40518887 |
ggttgctcaaatagttgaca |
40518906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 220
Target Start/End: Original strand, 25983955 - 25984037
Alignment:
| Q |
138 |
gttagtttgttttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagacggttgctcaaatagttga |
220 |
Q |
| |
|
||||| ||||||| || |||||||||| ||| ||| |||||| |||| |||||||||||| |||| ||||||| ||||||| |
|
|
| T |
25983955 |
gttagcttgttttggagtttatggaagtaccacaacctcaaagtgtgagatgatgttacagagacaactgctcaagtagttga |
25984037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University