View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976-Insertion-10 (Length: 370)
Name: NF4976-Insertion-10
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 172 - 367
Target Start/End: Complemental strand, 41941603 - 41941409
Alignment:
| Q |
172 |
cggagttaattctgtcagcaattgcgccattgttggtggtggtaccctaaaccctaaaaaattgatttaatttgttattgtaatttccaatgcccacnnn |
271 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41941603 |
cggagttaattctgtcagcaattgcaccattgttggtggtggtactctaaaccctaaaaaattgatttaatttgttattgttatttccaatgcccacttt |
41941504 |
T |
|
| Q |
272 |
nnnnnagtacctctttaccacaataactcattaattctattgtatgatatttttgcttcratctacaattgtttattcaaataatgatttttcaat |
367 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41941503 |
tttttagtacctctttaccacaataactcattatttctattgtat-atatttttgcttcaatctacaattgtttattcaaataatgatttttcaat |
41941409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 41941767 - 41941637
Alignment:
| Q |
8 |
acacagacacagattcactttcaccccaacatcatcaccttcaactcaacgcgcaataagatgttcaaaaagtacactctttctcactctactctctata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41941767 |
acacagacacagattcactttcaccccaacatcatcaccttcaactcaacgcaccataagatgttcaaaaagtacactctttctcactctactctctata |
41941668 |
T |
|
| Q |
108 |
ttctaattcatccattcaccatttgcttcta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41941667 |
ttctaattcatccattcaccatttgcttcta |
41941637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University