View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976-Insertion-13 (Length: 206)
Name: NF4976-Insertion-13
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold0361 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 41570071 - 41570270
Alignment:
| Q |
8 |
gttatcacttgtaaaattgtttcattctaaccctaacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatctttct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41570071 |
gttatcacttgtaaaattgtttcattctaaccctaacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatttttct |
41570170 |
T |
|
| Q |
108 |
ttcctgtttta-ttgttagatgtgttcgatccgttttcttctactaggagcttgaaccatgtctttaacatggtggatcaatcaattaacaatccgttcc |
206 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41570171 |
ttcctgttttattttttagatgtgttcgatccgttttcttctactaggagcttgaaccatgtccttaacatggtggatcaatcaattaacaatccgttcc |
41570270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 206
Target Start/End: Complemental strand, 9193 - 9109
Alignment:
| Q |
122 |
ttagatgtgttcgatccgttttcttctactaggagcttgaaccatgtctttaacatggtggatcaatcaattaacaatccgttcc |
206 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||| |||| ||| || |||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
9193 |
ttagatgtgtttgatccgttttctccaactaggagtttgagccaggtgcttaacatggtggatcaattaatggacaatccattcc |
9109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University