View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976_high_17 (Length: 239)
Name: NF4976_high_17
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976_high_17 |
 | |
|
| [»] scaffold0328 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0328 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 14490 - 14269
Alignment:
| Q |
18 |
ctaatgtcataggaagcacttggaatcagacgttacctacatgatagaggattgatgcaatatgcagataagttggaaaacagtgagaaaaatctagtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14490 |
ctaatgtcataggaagcacttggaatcagacgttacctacatgatagaggattgatgcaatatgcagataagttggaaaacagtgagaaaaatctagtag |
14391 |
T |
|
| Q |
118 |
agtttctcaaactaagcactaatgaacttgtttctcagtttgaaatgaaaagaggccacattgcccgtttcgttaacaaaaccaggcacgatgattcttt |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14390 |
agcttctcaaactaagcactaatgaacttgtttctcagtttgaaatgaaaagaggccacattgcccgtttcgttaacaaaaccaggcacgatgattcttt |
14291 |
T |
|
| Q |
218 |
caaacaacgtggacttactctt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14290 |
caaacaacgtggacttactctt |
14269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University