View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976_high_9 (Length: 379)
Name: NF4976_high_9
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 31 - 362
Target Start/End: Complemental strand, 1706610 - 1706277
Alignment:
| Q |
31 |
attgggagaagagcatttttctaattcttggcttttgaactattgaactattttgtttttgggtgatggctagaatggttccatttatttttgagaccat |
130 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1706610 |
attgggagaagagcaattttctaattcttggcttttgaactattgaactattttgtttttgggtgatggctagaatggttccatttattgttgagaccat |
1706511 |
T |
|
| Q |
131 |
gatggggaaattaatatatgatccatagctataatgataatggccaagattatttaagggatacctatactagtcaagtaaattagcaagaatcatatat |
230 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1706510 |
gatggggaaattaatat--gatccatagctataatgataatggccaagattatttaagggatacctatactagtcaagtaaattagcaaaaatcatatat |
1706413 |
T |
|
| Q |
231 |
tttcaattcaacccctatatatagataggaccaccata----atcatacacaattagggcaccgagctaaacgtcacttgtttttggtcctttataccat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1706412 |
tttcaattcaacccctatatatagataggaccaccataatcaatcatacacaattagggcaccgagctaaacgtcacttgtttttggtcctttataccat |
1706313 |
T |
|
| Q |
327 |
ttctctatatgtacttagtttattgatgtcttctct |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1706312 |
ttctctatatgtacttagtttattgatgtcttctct |
1706277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University