View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976_low_16 (Length: 250)
Name: NF4976_low_16
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976_low_16 |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0328 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 13724 - 13958
Alignment:
| Q |
11 |
agaatataaggttggcttcgtaattaggtaagcttcgtagttaggtaagagattgaagcagaagacttataattaagtaattcaagagttcgagatctcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13724 |
agaatataaggttggcttcgtaattaggtaagcttcgtagt-----aagagatttaagcagaagacttataattaagtaattcaagagttcgagatctcc |
13818 |
T |
 |
| Q |
111 |
aattagtataatactaacaatactaacttttgtcgttaaaaatgtttaccctggtcttcggagacacaagaaaacagctggtttatcgcgccaaagttcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13819 |
aattagtataatactaacaatactaacttttgtcgttaaaaatgtttaccctggtcttcggagacacaagaaaacagctggtttatcgcgccaaagttcg |
13918 |
T |
 |
| Q |
211 |
gatgcctttagtggtggtgttttcattttcaccaatggtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919 |
gatgcctttagtggtggtgttttcattttcaccaatggtt |
13958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 250
Target Start/End: Original strand, 27337213 - 27337308
Alignment:
| Q |
155 |
tttaccctggtcttcggagacacaagaaaacagctggtttatcgcgccaaagttcggatgcctttagtggtggtgttttcattttcaccaatggtt |
250 |
Q |
| |
|
|||||||||||| |||||||| | ||| |||||||||||||| ||||| ||||| | || || | ||| ||||| |||||||| |||||||||| |
|
|
| T |
27337213 |
tttaccctggtcgccggagacaaaggaacacagctggtttatctcgccacagttctgcagctttcattggaggtgtcttcatttttaccaatggtt |
27337308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University