View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4976_low_21 (Length: 205)
Name: NF4976_low_21
Description: NF4976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4976_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 52423385 - 52423219
Alignment:
| Q |
19 |
cagagacgaatccccttcgaaataagagatagaaacaatctcccaataaagtagaaatcaaacacaccagcctgcaaagaaccaacagcgctgcacttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52423385 |
cagagacgaatccccttcgaaataagagatagaaacaatctcccaataaagtagaaatcaaacacaccagcctgcaaagaaccaacagcgctgcacttta |
52423286 |
T |
 |
| Q |
119 |
ttggagatttaggnnnnnnncactgacttggaaacttgtaatctaaggaactggaatagatgctaat |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52423285 |
ttggagatttaggtttttttcactgacttggaaacttgtaatctaaggaactggaatagatgctaat |
52423219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 42716166 - 42716123
Alignment:
| Q |
143 |
gacttggaaacttgtaatctaaggaactgga-atagatgctaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
42716166 |
gacttggaaacttgtaatctaaggaattggagatagatgctaat |
42716123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University