View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4977_high_2 (Length: 259)
Name: NF4977_high_2
Description: NF4977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4977_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 151 - 257
Target Start/End: Original strand, 12640472 - 12640578
Alignment:
| Q |
151 |
aaaattgatcagcaatggaaggtagtgtcggagttgaacggccattgaaactttacttgcttccatttctatcacctggtcatatgattcctttgggtga |
250 |
Q |
| |
|
|||| |||||||||||||||| | |||| |||||||||||||||||||||||| | | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12640472 |
aaaactgatcagcaatggaagatggtgttggagttgaacggccattgaaacttctcatacttccatttctagcacctggtcatatgattcctttgggtga |
12640571 |
T |
 |
| Q |
251 |
catagca |
257 |
Q |
| |
|
||||||| |
|
|
| T |
12640572 |
catagca |
12640578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 48963446 - 48963371
Alignment:
| Q |
182 |
agttgaacggccattgaaactttacttgcttccatttctatcacctggtcatatgattcctttgggtgacatagca |
257 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963446 |
agttgaacgaccattgaaacttcacttcattccatatcttgcacctggtcatatgattcctttgggtgacatagca |
48963371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 12482477 - 12482533
Alignment:
| Q |
182 |
agttgaacggccattgaaactttacttgcttccatttctatcacctggtcatatgat |
238 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||| | ||||||| |||||||| |
|
|
| T |
12482477 |
agttgaacgaccattgaaacttcacttcattccatttccagcacctgggcatatgat |
12482533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University