View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4977_low_4 (Length: 256)
Name: NF4977_low_4
Description: NF4977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4977_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 59 - 241
Target Start/End: Original strand, 38001755 - 38001937
Alignment:
| Q |
59 |
cagattaaagaccagatgacattagttgtggcctattttgcagtggttcgtcgtaaacctgaaagggtatgttctattatcccaaaagggctgtttgttt |
158 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001755 |
cagattaaagaccggatgacattagttgtggcctattttgcagtggttcgtcgtaaacctgaaagggtatgttctattatcccaaaagggctgtttgttt |
38001854 |
T |
 |
| Q |
159 |
tataacgtgttggactcatccctcgatgtgggttcaatcgcgtctaaagccggttgtattgatggtcctagctcgtttctctg |
241 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001855 |
tataacatgttggactcatccctcgatatgggttcaatcgcgtctaaagccggttgtattgatggtcctagctcgtttctctg |
38001937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 5906848 - 5906928
Alignment:
| Q |
157 |
tttataacgtgttggactcatccctcgatgtgggttcaatcgcgtctaaagccggttgtattgatggtcctagctcgtttct |
238 |
Q |
| |
|
||||||||||||||| ||||||| || || ||||||||| ||| ||| || |||||||| ||| |||||||||||| ||||| |
|
|
| T |
5906848 |
tttataacgtgttggcctcatcc-tcaatttgggttcaaacgcatctgaaaccggttgtgttggtggtcctagctcatttct |
5906928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University