View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978-Insertion-17 (Length: 145)
Name: NF4978-Insertion-17
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978-Insertion-17 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 9e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 8270234 - 8270353
Alignment:
| Q |
26 |
caatagctcgatgcgattttgcaccatatggaaaagattttccaggagggattgcaacaggtcgatttagcaacggaaaggttccatcagaccttatagg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8270234 |
caatagctcgatgcgattttgcaccatatggaaaagattttccaggagggattgcaacaggtcgatttagcaacggaaaggttccatcagaccttatagg |
8270333 |
T |
|
| Q |
126 |
tatacatattctcatctcaa |
145 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8270334 |
tatacatattctcatctcaa |
8270353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 49 - 127
Target Start/End: Original strand, 8252684 - 8252762
Alignment:
| Q |
49 |
ccatatggaaaagattttccaggagggattgcaacaggtcgatttagcaacggaaaggttccatcagaccttataggta |
127 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||||| |||||||||| |||||||||||| |||| |||||||||| |
|
|
| T |
8252684 |
ccatatggaaaagattttcaaggaggaattccaacaggaagatttagcaatggaaaggttccagcagatcttataggta |
8252762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 8242708 - 8242772
Alignment:
| Q |
49 |
ccatatggaaaagattttccaggagggattgcaacaggtcgatttagcaacggaaaggttccatc |
113 |
Q |
| |
|
|||||||| ||||||||| |||||| ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8242708 |
ccatatgggaaagattttaaaggaggaattccaacaggaagatttagcaacggaaaggttccatc |
8242772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University