View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_high_24 (Length: 277)
Name: NF4978_high_24
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 48 - 258
Target Start/End: Original strand, 42323826 - 42324036
Alignment:
| Q |
48 |
gacatatttaatcaaagcttcttcacatttccaagtctcgaatcaagttttacgagtttgaagtaattatctttcaatcaagggacctctcaggaaattg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42323826 |
gacatatttaatcaaagcttcttcacattgccaagtctcgaatcaagtttcacgagtttgaagtaattatctttcaaccaagggacctctcaggaaattg |
42323925 |
T |
 |
| Q |
148 |
gcatataaatgtgactttaacacttagattaatataagatgactaattttatatcccactgttttcaatttcttatggttaactttcaatcttactttca |
247 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42323926 |
gcatataattgtgattttaacacttagattaatataagatgactaattttatatcccactgttttcaatttcttatggttaactttcaatcttactttca |
42324025 |
T |
 |
| Q |
248 |
cattgttactc |
258 |
Q |
| |
|
||||||||||| |
|
|
| T |
42324026 |
cattgttactc |
42324036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 143
Target Start/End: Original strand, 27235812 - 27235862
Alignment:
| Q |
93 |
agttttacgagtttgaagtaattatctttcaatcaagggacctctcaggaa |
143 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
27235812 |
agtttcacgaggttgaagtatttatctttcaaccaagtgacctctcaggaa |
27235862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University