View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_high_32 (Length: 251)
Name: NF4978_high_32
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_high_32 |
 | |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 150 - 251
Target Start/End: Complemental strand, 15427201 - 15427099
Alignment:
| Q |
150 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttggtgatgatggcctagtggttggataaagaactttctgaatgcttgtg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427201 |
aaagatctgatccatggttggaagtttagtcccagtggatttagaggtagttggtgatgatggcctagtggttggataaagaactttctgaatgcttgtg |
15427102 |
T |
|
| Q |
249 |
ttt |
251 |
Q |
| |
|
||| |
|
|
| T |
15427101 |
ttt |
15427099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 84
Target Start/End: Complemental strand, 15427335 - 15427267
Alignment:
| Q |
16 |
atgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427335 |
atgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
15427267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 150 - 246
Target Start/End: Complemental strand, 15436622 - 15436522
Alignment:
| Q |
150 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttggtgatg---atggcctagtggttggataaagaactttctgaatgctt |
245 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||| |||||||||||||||| || | ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
15436622 |
aaagatctgccccatggttggatgtttagtcccagttgatttagaggtagttgttgtagtcgatggccttgttgttggataaagaactttctgaatgctt |
15436523 |
T |
|
| Q |
246 |
g |
246 |
Q |
| |
|
| |
|
|
| T |
15436522 |
g |
15436522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 246
Target Start/End: Complemental strand, 15442940 - 15442897
Alignment:
| Q |
203 |
tgatgatggcctagtggttggataaagaactttctgaatgcttg |
246 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
15442940 |
tgatgatggcctagtagttgggtaaagaactttctgaatgcttg |
15442897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University