View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_high_34 (Length: 251)
Name: NF4978_high_34
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 28431782 - 28431561
Alignment:
| Q |
11 |
cagagaggcaaccacacgatgtacaaatagatactaatactgaactatgatgcaaatcaatcaattcagaaaatcattttctgattatattctctctctc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28431782 |
cagagaggcaaccacacgatgtacaaatagataataatactgaactatgatgcaaatcaatcaattcagaaaatcattttctgattatattctctctctc |
28431683 |
T |
 |
| Q |
111 |
tttcctcggcataggttttatcagaatccagtttttgtggttttgatttgagtttctgaactatgttggcaatcaattacgaatccgggatttagtgtct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28431682 |
tttcctcggcataggttttatcagaatcaagtttttgtggttttgatttgagtttcagaactatgttggcaatcaattacgaatccgggatttagtgtct |
28431583 |
T |
 |
| Q |
211 |
acccataatcaacagttctaat |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28431582 |
acccataatcaacagttctaat |
28431561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University