View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_high_38 (Length: 244)
Name: NF4978_high_38
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 138 - 229
Target Start/End: Complemental strand, 2671290 - 2671199
Alignment:
| Q |
138 |
ttttatctcaaaatatcctttgctcagattttatattcctaaccacgtttcaaattatataactgaaatcatcaagatttagagaatattat |
229 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2671290 |
ttttttctcaaaatatcctttgctcagattttatattcctagccacgtttcaaattatataactgaaatcatcaagatttagagaatattat |
2671199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 2671486 - 2671403
Alignment:
| Q |
1 |
caaatttttgttatttatcagctttgcactttccaaaaatttggaagttttgtgtcnnnnnnnctcttctgcgtttcaagttgcag |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
2671486 |
caaatttttgttatttatcagctttgcactttccaaaaatttggaagctt--tgtctttttttctcttctgcgtttcaagttgcag |
2671403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 144
Target Start/End: Complemental strand, 2671367 - 2671326
Alignment:
| Q |
103 |
acaagcgcaatactgaattgataaataaaataggcttttatc |
144 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2671367 |
acaagcgcaatactgaattgataaaaaaaataggcttttatc |
2671326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University