View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_low_12 (Length: 431)
Name: NF4978_low_12
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 6e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 265 - 419
Target Start/End: Original strand, 40318014 - 40318168
Alignment:
| Q |
265 |
agcacttcaatttcgcagagtggcgtccacaccgtatctacttttgaaccgttaatccccagaagcctctatctttccttgtttactgataccttcctcc |
364 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40318014 |
agcacttcaatttcgcagagtggcttccacaccgtatctacttttgaaccgttaatccccggaagcatctatctttccttgtttactgataccttcctcc |
40318113 |
T |
 |
| Q |
365 |
aagctgtggatcgatgcaagtgatcagaagtagcttgcttttgttgtctcagtat |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40318114 |
aagctgtggatcgatgcaagtgatcagaagtagcttgcttttgttgtctcagtat |
40318168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 40317771 - 40317970
Alignment:
| Q |
18 |
tgtttgtatgtttgattgttgtgnnnnnnnnctgtgttttgaaaaataggcggctattgctggcaatgctggaggagggacctgattttgcagcatgttt |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317771 |
tgtttgtatgtttgattgttgtgttttttttctgtgttttgaaaaataggcggctattgctggcaatgctggaggagggacctgattttgcagcatgttt |
40317870 |
T |
 |
| Q |
118 |
ctcatgttgtaggannnnnnnnnnnnnnnnnncttctagtaagtcaatgggtcttctgctcttgtccgtcacccttttgctttcctaaattactcgggcc |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
40317871 |
ctcatgttgtagga---tttttttttctttttcttctagtaagtcaat-ggtcttctgctcttgtccgtcacccttttgctttcctaaattacacgtgcc |
40317966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University