View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_low_19 (Length: 313)
Name: NF4978_low_19
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 161 - 302
Target Start/End: Complemental strand, 7669151 - 7669011
Alignment:
| Q |
161 |
aaaatttacttgttttgaatgtttaacttgcctttgtggcactaattagcattctcttaaatgtaaaagnnnnnnntaatattttctactatcattaata |
260 |
Q |
| |
|
|||||||| || ||||||||| |||| || ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7669151 |
aaaatttatttattttgaatgcttaatttatctttgtggcactagttagcattctcttaaatgtaaaagaaaaaa-taatattttctactatcattaata |
7669053 |
T |
 |
| Q |
261 |
atttaaaaataaatgagtatccactcctctcatattcttgga |
302 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7669052 |
aattaaaaataaatgagtatccactcctctcatattattgga |
7669011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 7669293 - 7669247
Alignment:
| Q |
19 |
attcctctatttaaaagtagaattttgttaacaagtgcctccgaaat |
65 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| |||| ||||| |
|
|
| T |
7669293 |
attcctctatttaaacgtacaattttgttaacaagtacctctgaaat |
7669247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University