View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_low_23 (Length: 291)
Name: NF4978_low_23
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 274
Target Start/End: Complemental strand, 37135631 - 37135369
Alignment:
| Q |
12 |
acagacaacaaagcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135631 |
acagacaacaaagcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccgg |
37135532 |
T |
|
| Q |
112 |
aaccgacaactgcaccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatctccacaatttccat |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135531 |
aaccgacaactgcgccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatctccacaatttccat |
37135432 |
T |
|
| Q |
212 |
gtaatcttttgatcgtgtaaacattctatctttcaacctgtatggtgttttcatgaatgcttt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135431 |
gtaatcttttgatcgtgtaaacattctatctttcaacctgtatggtgttttcatgaatgcttt |
37135369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University