View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_low_29 (Length: 264)
Name: NF4978_low_29
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 9939177 - 9939413
Alignment:
| Q |
7 |
ggagcagagaggagcgctggtgttggtcgacttccggtcttgttttgacgcggagatggtggcgtccatagttggatatttaaacatcatgatacatgca |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
9939177 |
ggagtagagaggagcgctggtgttggtcgaattccggtcttgttttgacgcggagatggtggcgtccatggttggatatttaaacat---gatacatgca |
9939273 |
T |
|
| Q |
107 |
gctaacaaaattggatatttaaacatcattgtctatggtcttaacttggataattaatgaacgtacttgttttactctttaatatgcagggtactttggg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939274 |
gctaacaaaattggatatttaaacatcattgtctatggtcttaacttggaaaatcaatgaacgtacttgttttactctttaatatgcagggtactttggg |
9939373 |
T |
|
| Q |
207 |
aatgaaaacatagcattcttcaaattttagtgcttataat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939374 |
aatgaaaacatagcattcttcaaattttagtgcttataat |
9939413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University