View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4978_low_50 (Length: 207)
Name: NF4978_low_50
Description: NF4978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4978_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 47600732 - 47600542
Alignment:
| Q |
1 |
aacgtaatttgaatcagtcattaaagcaatggagaaattcatgaacaaatctaaagaatgaggggaaaaattgatgacagtgagaaaagtttccaacctc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47600732 |
aacgtaatttgattcagtcattaaagcaatggagaaattcatgaacgaatctacagaatgagggaaaaaattgatgacagtgagaaaagtttccaacctc |
47600633 |
T |
 |
| Q |
101 |
aattgacgaccagcttggctcgccggagttgcgatttctggaatggaacaaaagaaatcgcagcggcggcgaaaggtggttacgatctgtg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47600632 |
aattgacgaccagcttggctcgccggagttgcaatttctggaatggaacaaaagaaatcgcagcggcggcgaaaggtggttacgatctgtg |
47600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University