View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4979_high_2 (Length: 304)

Name: NF4979_high_2
Description: NF4979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4979_high_2
NF4979_high_2
[»] scaffold0147 (1 HSPs)
scaffold0147 (1-288)||(13472-13759)


Alignment Details
Target: scaffold0147 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: scaffold0147
Description:

Target: scaffold0147; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 13472 - 13759
Alignment:
Q  1 gtgctgagatcagattgcaagatatcatagaactcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13472 gtgctgagatcagattgcaagatatcatagaactcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaa 13571  T
Q  101 gagatcttggaagtttttggtaccctccagagaaaaaagacctgaaattttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13572 gagatcttggaagtttttggtaccctccagagaaaaaagacctgaagttttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttag 13671  T
Q  201 gtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtata 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13672 gtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtata 13759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University