View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4979_high_7 (Length: 219)
Name: NF4979_high_7
Description: NF4979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4979_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 45289471 - 45289265
Alignment:
| Q |
1 |
atgaatctccagggtctttatcttcatcggataacaattatgaggtcatataaaacagagcccatatcaagcataatcccatcctcagcagtggccatat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
45289471 |
atgaatctccaaggtctttatcttcatcggataacaattatgaggtcataaaaaacagagcccatatcaagcataatcacatcctcagcggtggccatat |
45289372 |
T |
 |
| Q |
101 |
caaacacctcaccaccaaaaagtgatgattggggtctaattttgattattagggatgtaattggtgctttctattccttattgaggattacttacaaaga |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45289371 |
caaacacctcaccacc-aaaagtgatggttggggtctaattttgtttattagggatgtaattggtgctttctattccttattgaggcttacttacaaaga |
45289273 |
T |
 |
| Q |
201 |
ttatgtag |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
45289272 |
ttatgtag |
45289265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University