View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4979_high_8 (Length: 218)

Name: NF4979_high_8
Description: NF4979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4979_high_8
NF4979_high_8
[»] chr1 (1 HSPs)
chr1 (102-218)||(31140094-31140210)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 31140094 - 31140210
Alignment:
102 ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31140094 ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag 31140193  T
202 tacaacaaggaattaca 218  Q
    |||||||||||||||||    
31140194 tacaacaaggaattaca 31140210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University