View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4979_low_2 (Length: 304)
Name: NF4979_low_2
Description: NF4979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4979_low_2 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 13472 - 13759
Alignment:
| Q |
1 |
gtgctgagatcagattgcaagatatcatagaactcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13472 |
gtgctgagatcagattgcaagatatcatagaactcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaa |
13571 |
T |
 |
| Q |
101 |
gagatcttggaagtttttggtaccctccagagaaaaaagacctgaaattttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13572 |
gagatcttggaagtttttggtaccctccagagaaaaaagacctgaagttttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttag |
13671 |
T |
 |
| Q |
201 |
gtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtata |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13672 |
gtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtata |
13759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University