View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4979_low_8 (Length: 218)
Name: NF4979_low_8
Description: NF4979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4979_low_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 31140094 - 31140210
Alignment:
| Q |
102 |
ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31140094 |
ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag |
31140193 |
T |
|
| Q |
202 |
tacaacaaggaattaca |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31140194 |
tacaacaaggaattaca |
31140210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University