View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4980_high_3 (Length: 352)
Name: NF4980_high_3
Description: NF4980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4980_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 3 - 343
Target Start/End: Original strand, 38522293 - 38522634
Alignment:
| Q |
3 |
ttacttttgttgcaagctagctctgcgaggttgacatcactttattgtcgtggatgacacaattcaaaggtttctcttttgggaatctctctatttaccg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38522293 |
ttacttttgttgcaagctagctctgcgaggttgacatcactttattgtcgtagatgacacaattcaaaggtttctcttttgggaatctttctatttaccg |
38522392 |
T |
 |
| Q |
103 |
tagcaacagaaaaagaaaggattcaactcactcactttcttattaatttgcatgttgttattgtggtttctaattttgatcgacgttgaca-ttttaaga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38522393 |
tagcaacagaaaaagaaaggattcaactcactcactttcttattaatttgcatgttgttattgtggtttctaattttgatcgacgttgacatttttaaga |
38522492 |
T |
 |
| Q |
202 |
catgcatgtgaaaataaacggtgatgataatgattgtgccccgccacgaaatattccattttgctgacgggcggagacgattgtaaaattgcttcattat |
301 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38522493 |
catgcatgtgaaaataaatggtgatgataatgattgtgccccgccacgaaatattccattttgctgacgggtggagacgattgtaaaattgcttcattat |
38522592 |
T |
 |
| Q |
302 |
tttttcttcatattttactataaaagtaattcagagtataat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38522593 |
tttttcttcatattttactataaaagtaattcagagtataat |
38522634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University