View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4980_low_1 (Length: 273)
Name: NF4980_low_1
Description: NF4980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4980_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 74 - 216
Target Start/End: Complemental strand, 40197459 - 40197322
Alignment:
| Q |
74 |
gtcctagtcaatgttactcaagacaagcaccaggttggtgcatcaaacaatagcgccaaattcatggtggtagaaaatgaacttgtccatggtgagtacg |
173 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40197459 |
gtcctagtcaatgttact-aagacaagcaccaggttggtgcatcaaacaatagcgccaaattcatggtggtagaaaatgaacttgtccatggtga----g |
40197365 |
T |
 |
| Q |
174 |
taatatcaaaagtagatatcgtagatgcataaattgtaagttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40197364 |
taatatcaaaagtagatatcgtagatgcataaattgtaagttc |
40197322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University