View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4981_low_14 (Length: 306)
Name: NF4981_low_14
Description: NF4981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4981_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 151 - 279
Target Start/End: Original strand, 30683871 - 30683999
Alignment:
| Q |
151 |
cttgaggaaatctgggattgatgttctgttggttatttatcatgtcggcagataatattacaatctattggagaagttgtagatcttgcgcctatgattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683871 |
cttgaggaaatctgggattgatgttctgttggttatttatcatgtcggcagataatattacaatctattggagaagttgtagatcttgcgcctatgattt |
30683970 |
T |
 |
| Q |
251 |
catataaaggagaagctacaattggatcc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30683971 |
catataaaggagaagctacaattggatcc |
30683999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 113
Target Start/End: Original strand, 30683740 - 30683833
Alignment:
| Q |
20 |
atactatgtgtttaacctacactagctagagagagttaaacttcactgctgtaactaactaaatacaaagaatatttaaactagaaaattaatc |
113 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30683740 |
atactgtgtgtttaacctacactagctggagagagttaaacttcactactgtaactaactaaatgcaaagaatatttaaactagaaaattaatc |
30683833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University