View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4981_low_17 (Length: 260)
Name: NF4981_low_17
Description: NF4981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4981_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 260
Target Start/End: Original strand, 17576747 - 17576991
Alignment:
| Q |
16 |
ataataatgagattcacacttcataannnnnnncacataatcatactatgtgaaaaatctaatatgaatgggtccatttccattcaagctgttctttgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576747 |
ataataatgagattcacacttcataatttttttcacataatcatactatgtgaaaaatctaatatgaatgggtccatttccattcaagctgttctttgag |
17576846 |
T |
 |
| Q |
116 |
ttttaatgaaagcttcttagggataggagagatttaatctgaaattttgtgatcctttacatgctacaactccctttttactaaaaaccataacaatatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17576847 |
ttttaatgaaagcttcttagggataggagagatttaatctgaaattttgtgaccctttacatgctacaactccctttttactaaaaaccataacaatacc |
17576946 |
T |
 |
| Q |
216 |
tcgtggcataaaggttagtagtattcaggttacttgttagcatta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576947 |
tcgtggcataaaggttagtagtattcaggttacttgttagcatta |
17576991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University