View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4981_low_22 (Length: 233)
Name: NF4981_low_22
Description: NF4981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4981_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 48861293 - 48861487
Alignment:
| Q |
17 |
agcaaaggcagagcaagagagcagcagcataccaacgctccctttgttctctgtctcaccagcagcaatgaaaattcaaatgcaaatggaatccccagag |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861293 |
agcaaaggcagagcaagagagca---gcataccaaggctccctttgttctctgtctcaccagcagcaatgaaaattcaaatgcaaatggaatccccagag |
48861389 |
T |
|
| Q |
117 |
agaacggggacggtgactccaccactgcaaacctcaggttcagtaccatttctttgggaacaagaaccaggaaagccaaggctttgcaatgcacttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861390 |
agaacggggacggtgactccaccacttcaaacctcaggttcagtaccatttctttgggaacaagaaccaggaaagccaaggctttgcaatgcacttgt |
48861487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University