View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4981_low_7 (Length: 425)
Name: NF4981_low_7
Description: NF4981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4981_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 83 - 205
Target Start/End: Complemental strand, 38256152 - 38256033
Alignment:
| Q |
83 |
tccaataatagtcgtcaagaaaaaacactatttggaattattttattgctctccctggataaaaatttgcacatctaagagaccatttacacaaaccagt |
182 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
38256152 |
tccaataatagtcgtaaa---aaaacactatttggaattattttattgcttaccctggataaaaaattgcaaatctaggagaccatttacacaaaccaga |
38256056 |
T |
 |
| Q |
183 |
gctagcataccaaagacaagatt |
205 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38256055 |
actagcataccaaagacaagatt |
38256033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 32812184 - 32812147
Alignment:
| Q |
1 |
tggtgtgatactcaaagaactaagagataattgaatat |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32812184 |
tggtgtgatactcaaagaactaagagatgtttgaatat |
32812147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University