View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982-Insertion-11 (Length: 132)
Name: NF4982-Insertion-11
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982-Insertion-11 |
 | |
|
| [»] scaffold0318 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0318 (Bit Score: 85; Significance: 6e-41; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 4767 - 4643
Alignment:
| Q |
8 |
agttaattgttgtctattaatttctcaggacatttaactgtcgttatggtctggttttatattaaaacatcaacgtcaactcccacattgtcaaaaagca |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||| | ||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4767 |
agttaattgtcgtctattaatttctcaaaacaattaactatggttgtggtttggttttatactaaaacatcaacgtcaactcccacattgtcaaaaagca |
4668 |
T |
|
| Q |
108 |
cataaacaaaaactttcctctctcc |
132 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
4667 |
cataaacaaaaactttcctccctcc |
4643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University