View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982-Insertion-5 (Length: 153)
Name: NF4982-Insertion-5
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982-Insertion-5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 153
Target Start/End: Complemental strand, 45625916 - 45625771
Alignment:
| Q |
8 |
ctaattgtccttgcaggtgagccgggaacaccgccttgcgtttcttttgcaaaccacctccacctgcaccaactctttcttcagggttctttatttgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45625916 |
ctaattgtccttgcaggtgagccgggaacatcgccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaat |
45625817 |
T |
 |
| Q |
108 |
tatgaacgatccctcacgttcaatgttgagtgcttcctggggttca |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45625816 |
tatgaacgatccctcacgttcaatgttgattgcttcctggggttca |
45625771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University