View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982-Insertion-9 (Length: 214)
Name: NF4982-Insertion-9
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 10424910 - 10424705
Alignment:
| Q |
8 |
aaaatgattctatagaatatggtgtggctgatcaatcttatgttggagtgatatctacttcttaggatataatgttatgggcaatccattttggggaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10424910 |
aaaatgattctatagaatatggtgtggctgatcaatcttatgttgaagtgttatctacttcttaggatataatgttatgggcaatccattttggggaaga |
10424811 |
T |
|
| Q |
108 |
gcaaaagggccatattgaatcccattctttgtaccctccacagaccacctgcagataataatgcaaacaaaaattagaaacaaaattctaaaaatttaga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
10424810 |
gcaaaagggccatattgaatcccattctttgtaccctccacagaccacctgtagataataatgcaaac-aaaattagaaacaaaattataaaaatttaga |
10424712 |
T |
|
| Q |
208 |
atatctc |
214 |
Q |
| |
|
||||||| |
|
|
| T |
10424711 |
atatctc |
10424705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 157
Target Start/End: Original strand, 30522063 - 30522127
Alignment:
| Q |
93 |
ccattttggggaagagcaaaagggccatattgaatcccattctttgtaccctccacagaccacct |
157 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| || |||||| ||| ||||||||||||| |
|
|
| T |
30522063 |
ccattttgaggaagagcaaaaggaccatactgaattccgttcttttcaccgaccacagaccacct |
30522127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University