View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4982_high_10 (Length: 269)

Name: NF4982_high_10
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4982_high_10
NF4982_high_10
[»] chr2 (1 HSPs)
chr2 (31-247)||(32498481-32498703)
[»] chr1 (1 HSPs)
chr1 (47-153)||(37185246-37185353)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 31 - 247
Target Start/End: Original strand, 32498481 - 32498703
Alignment:
31 aaacatcaaacttaggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtca 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||    
32498481 aaacatcaaacttaggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacaaccatgatgacctcttca 32498580  T
131 tttacccgatttgcaaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgat------ttagcaatctactttgtctt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||    
32498581 tttacccgatttgcaaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgatcctgacttagcaatctactttgtctt 32498680  T
225 ctcacacctctgatgtgcagtgt 247  Q
    ||||||||| |||||||||||||    
32498681 ctcacacctatgatgtgcagtgt 32498703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 153
Target Start/End: Complemental strand, 37185353 - 37185246
Alignment:
47 aagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtcatttacccgatt-tgca 145  Q
    ||||| |||| | ||||| |||| ||||||||| ||||||| |||||||||||  ||   |||||| ||||||| ||||||||| |||| ||||| | ||    
37185353 aagtctattatcccatcattatctggtcaccaatcatgatactcacatcacttgcccaccggcacaaccatgataacctcgtcacttactcgattgtcca 37185254  T
146 accatgat 153  Q
    ||||||||    
37185253 accatgat 37185246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University