View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_high_10 (Length: 269)
Name: NF4982_high_10
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 31 - 247
Target Start/End: Original strand, 32498481 - 32498703
Alignment:
| Q |
31 |
aaacatcaaacttaggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
32498481 |
aaacatcaaacttaggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacaaccatgatgacctcttca |
32498580 |
T |
|
| Q |
131 |
tttacccgatttgcaaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgat------ttagcaatctactttgtctt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32498581 |
tttacccgatttgcaaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgatcctgacttagcaatctactttgtctt |
32498680 |
T |
|
| Q |
225 |
ctcacacctctgatgtgcagtgt |
247 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
32498681 |
ctcacacctatgatgtgcagtgt |
32498703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 153
Target Start/End: Complemental strand, 37185353 - 37185246
Alignment:
| Q |
47 |
aagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtcatttacccgatt-tgca |
145 |
Q |
| |
|
||||| |||| | ||||| |||| ||||||||| ||||||| ||||||||||| || |||||| ||||||| ||||||||| |||| ||||| | || |
|
|
| T |
37185353 |
aagtctattatcccatcattatctggtcaccaatcatgatactcacatcacttgcccaccggcacaaccatgataacctcgtcacttactcgattgtcca |
37185254 |
T |
|
| Q |
146 |
accatgat |
153 |
Q |
| |
|
|||||||| |
|
|
| T |
37185253 |
accatgat |
37185246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University