View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_low_12 (Length: 257)
Name: NF4982_low_12
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_low_12 |
 |  |
|
| [»] scaffold1847 (1 HSPs) |
 |  |  |
|
| [»] scaffold0768 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1847 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: scaffold1847
Description:
Target: scaffold1847; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 15 - 122
Target Start/End: Original strand, 1193 - 1300
Alignment:
| Q |
15 |
gagcaaaaccctagaggtataggcgggagctgcaaactccggcagcggggaattatggggtttttcagtcacaaccatgacatccgctattgggggaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
1193 |
gagcaaaaccctagaggtataggcgggagctgcaaactccggcagcggtgaattatggtgttttttagtcacaaccatgacatccgctattggggtaata |
1292 |
T |
 |
| Q |
115 |
tctagcat |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
1293 |
tctagcat |
1300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0768 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0768
Description:
Target: scaffold0768; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 159 - 244
Target Start/End: Original strand, 5 - 90
Alignment:
| Q |
159 |
cgccgggggaagtgctctgatcataaaatgcgaataaagatttttgcatgagatattatgtgcaaagggggataaaatcctaagac |
244 |
Q |
| |
|
|||||| | |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
5 |
cgccggtgaaagtgctctgatcataaaatgcaaataaagatttttgcatgagatattaggtgcaaaggtggataaaatcctaagac |
90 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University