View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_low_14 (Length: 240)
Name: NF4982_low_14
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 42880874 - 42880673
Alignment:
| Q |
19 |
attagtcccagaaagagatgatgatcgatgcaaatatttttcatttcacatttcccaaatctgaaaactaggcatgaaacttccttgcctttgcctccgt |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42880874 |
attagtcccaaaaagagatgatgatcgatgcaaatatttttcatttcacatttcccaaatctgaaaactaggcatgaaacttccttgcctttgcctccgt |
42880775 |
T |
 |
| Q |
119 |
tgtccatggatagnnnnnnnttccaataccaaaagagatgactacattaacaaaacacaatatagtggttctaagtaggtaactcggttaataagttaaa |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42880774 |
tgtccatggatagaaaaaaattccaataccaaaagagatgactacattaacaaaacacaatatagtggttctaagtaggtaactcggttaataagttaaa |
42880675 |
T |
 |
| Q |
219 |
ca |
220 |
Q |
| |
|
|| |
|
|
| T |
42880674 |
ca |
42880673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 131
Target Start/End: Complemental strand, 42881147 - 42881094
Alignment:
| Q |
78 |
tctgaaaactaggcatgaaacttccttgcctttgcctccgttgtccatggatag |
131 |
Q |
| |
|
||||||||| || ||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
42881147 |
tctgaaaaccagacatgaaatttccttgcatttgcctaagttgtccatggatag |
42881094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University