View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_low_17 (Length: 215)
Name: NF4982_low_17
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 40057375 - 40057572
Alignment:
| Q |
1 |
aaggcgccctttgtctatctcaaattcagttaccttaatcaaattgaaatatcttgtaacaaactacacctaatcacaggaggaaagataaaaacacgac |
100 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
40057375 |
aaggcgcccttcgtctatctcaaatgcagataccttaaacaaattgaaatatcttataacaaactacacctaatcacatgaggaaagataaaaacacg-c |
40057473 |
T |
|
| Q |
101 |
gtagcatatcaccataatacacccctataaataagtaaataatagtctcaaccctagtatgatcacacataacatatcttagttactcactttattact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057474 |
gtagcatatcaccataatacacccctataaataagtaaataatagtctcaaccctagtatgatcacacataacatatcttagttactcactttattact |
40057572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University