View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_low_18 (Length: 214)
Name: NF4982_low_18
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 37160488 - 37160313
Alignment:
| Q |
12 |
ccaagaatataaaacgaagggacacgtattaaatccatactctagtctagaaagttataatctaggacgacgaaatatggacaacaggcgccatgtgttc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
37160488 |
ccaaaaatataaaacgaagggacacgtattaaatccatactctagtctagaaagttataatctaggacgatgaaatatggacagcaggcgccatgtgttc |
37160389 |
T |
|
| Q |
112 |
attgctgaaagggtggaaaggccagataattaaattgaataggaagcagcatgacataaaaatagtactccaaata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
37160388 |
attgctgaaagggtggaaaggccagataattaaattgaataggaagcaacatgacacaaaaatagtattccaaata |
37160313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University