View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4982_low_9 (Length: 282)
Name: NF4982_low_9
Description: NF4982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4982_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 6169597 - 6169842
Alignment:
| Q |
18 |
cagagaggcgttcttaaaaaaccaacaatgcacttgtagagtggctttcaatgtcttaaaagtttaaattttatcttttcaatataaaacttggctttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169597 |
cagagaggcgttcttaaaaaaccaacaatgcacttgtagagtggctttcaatgtcttaaaagtttaaattttatcttttcaatataaaacttggctttta |
6169696 |
T |
|
| Q |
118 |
attcnnnnnnnnnnnnnngcgacgtgatataaggcaatgcagcaactgcattgtgcatgtatgctctcattcttcaccaagtataatttattcaccggag |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169697 |
attctttttttagtttttgcgacgtgatataaggcaatgcagcaactgcattgtgcatgtatgctctcattcttcaccaagtataatttattcaccggag |
6169796 |
T |
|
| Q |
218 |
aattaaattcaaaggtgaagaatattaaaacaataactgattctct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169797 |
aattaaattcaaaggtgaagaatattaaaacaataactgattctct |
6169842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University