View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4983_low_1 (Length: 418)
Name: NF4983_low_1
Description: NF4983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4983_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 15 - 404
Target Start/End: Complemental strand, 36166808 - 36166418
Alignment:
| Q |
15 |
tcaaaggggtggaggaggaggcttgggaagagtttcaagtgattgggtagatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166808 |
tcaaaagggtggaggaggaggcttgggaagagtttcaagtgatcgggtggatgagttttgtgttgaaagaaaaattaaagagattcaaaggagtgattaa |
36166709 |
T |
|
| Q |
115 |
agagtggaataaggtggaatatgggaagttggaggataggctagtgttgcttatggaggaaattgcaaagttgtgagaagggagggagggagtttaacgc |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36166708 |
agagtggaataaggtggaatatgagaagttggaggatatgctagtgttgcttatggaggaaattgcaaagttgtgagaggggagggagggattttaacgc |
36166609 |
T |
|
| Q |
215 |
atgaggaggtggaggtgaggaaaattaaatttggggagctatggagacttttgagaagtaaagatggtttgttagttcaacgatctaagtctaaatggct |
314 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166608 |
atgcggaggtggaggtgaggaaaattaaatttggggagctatggagacttttgagaagtaaatatggtttgttagttcaacgatctaagtctaaatggct |
36166509 |
T |
|
| Q |
315 |
taaaggaacggatgcaaactctaaa-ctttttcataattgtattaaaactagaaatagaagaaatgaaataaaggcaattaaggtggatga |
404 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166508 |
taaaggaacgaatgcaaactctaaatttttttcataattgtattaaagatagaaatagaagaaatgaaataaaggcaattaaggtggatga |
36166418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University