View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4985-Insertion-1 (Length: 345)
Name: NF4985-Insertion-1
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4985-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 8 - 345
Target Start/End: Original strand, 40368738 - 40369075
Alignment:
| Q |
8 |
gctctgtttgcaactttgttgaatttaataagaatttcagttaatcaaaatctagactaatctatatgttgttttattgtaggtttctattgctggttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368738 |
gctctgtttgcaactttgttgaatttaataagaaattcagttaatcaaaatctagactaatctatatgttgttttattgtaggtttctattgctggttat |
40368837 |
T |
|
| Q |
108 |
actgcgggtcaacgtgcgaaacaagtgcctcgtggaaaattggtagccggggcttccattctaacaggaactgccataactatgtttgttctagtggcac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368838 |
actgcgggtcaacgtgcgaaacaagtgcctcgtggaaaattggtagccggggcttccattctaacaggaactgccataactatgtttgttctagtggcac |
40368937 |
T |
|
| Q |
208 |
tcagcgtcttccctttcactcccagatatatcatccctgttgcaggcatgatggttggaaactcgatgaccgttaccggagttaccatgaaaagactccg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
40368938 |
tcagcgtcttccctttcactcccagatatatcatccctgttgcaggcatgatggttggaaactcaatgaccgttaccggagttaccatgaaaagactcag |
40369037 |
T |
|
| Q |
308 |
agacgacatcaaagcacaaatgaacttggtatgtcatc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369038 |
agacgacatcaaagcacaaatgaacttggtatgtcatc |
40369075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University