View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4985-Insertion-2 (Length: 189)
Name: NF4985-Insertion-2
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4985-Insertion-2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 16648160 - 16648341
Alignment:
| Q |
8 |
atttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattgattatgaaaggtaattgattatgaaacctttcacttttcttcctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16648160 |
atttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattaattatgaaaggtaattgattatgaaacctttcacttttcttcctt |
16648259 |
T |
|
| Q |
108 |
gattctacttacttataagttgtgtgaaggatcataaatccaaacttcactattctttttgttcatgagaacacacaccatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16648260 |
gattctacttacttataagttgtgtgaaggatcataaatccaaacttcactattctttttgttcatgagaacacacaccatg |
16648341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University