View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4985_high_9 (Length: 244)
Name: NF4985_high_9
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4985_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 133
Target Start/End: Original strand, 11626251 - 11626367
Alignment:
| Q |
17 |
aacattttcctcaccagcaatcataagagcttcactctccccaggaaaaagaatcttcttcccaaaaagcttaatttcagggtccttagtttcaatcatt |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11626251 |
aacattttcctcaccatcaatcataagagcttcaccttccccaggaaaaagaatcttcttcccaaagagcttaatttcagggtccttagtttcaatcatt |
11626350 |
T |
|
| Q |
117 |
tcttccttcttaagatc |
133 |
Q |
| |
|
| || |||||||||||| |
|
|
| T |
11626351 |
tttttcttcttaagatc |
11626367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 244
Target Start/End: Original strand, 11626413 - 11626479
Alignment:
| Q |
177 |
gcgcgagacagttattagttaaggtttctgtttgttttgaagaaagagtttcggttttttcgatgttg |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626413 |
gcgcgagacagttattagttaaggtta-tgtttgttttgaagaaagagtttcggttttttcgatgttg |
11626479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University