View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4985_low_12 (Length: 241)
Name: NF4985_low_12
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4985_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 34533794 - 34533639
Alignment:
| Q |
5 |
catcatcatcatcagcagcagcatgcagtacttgcctagtttgatatgggagctgaaaatttccataaactagcttgaggcaatcacaccaattatgaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533794 |
catcatcatcatcagcagcagcatgcagtacttgcctagtttgatatgggagctgaaaatttccataaactagcttgaggcaatcacaccaattatgaag |
34533695 |
T |
 |
| Q |
105 |
tggaaggccta-aaaccatccatggggaattaagcattcctggtccgaattatatc |
159 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533694 |
tggaaggcctagaaaccatccatggggaattaagcattcctggtccgaattatatc |
34533639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University